ds gene 1.5 program for dna analysis (Accelrys)
90
Structured Review
Accelrys
ds gene 1.5 program for dna analysis
Ds Gene 1.5 Program For Dna Analysis, supplied by Accelrys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ds+gene+1%2E5+program+for+dna+analysis/ds+gene+1+5/pmc03494587-390-126-129
Average 90 stars, based on 1 article reviews
Ds Gene 1.5 Program For Dna Analysis, supplied by Accelrys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ds+gene+1%2E5+program+for+dna+analysis/ds+gene+1+5/pmc03494587-390-126-129
Average 90 stars, based on 1 article reviews
ds gene 1.5 program for dna analysis - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
other:Article Title: Depletion of L -arginine induces autophagy as a cytoprotective response to endoplasmic reticulum stress in human T lymphocytes Article Snippet: The primers used are listed below, where the nucleotide numbers indicate the primer location in the corresponding human sequences obtained from the GenBank/EMBL database: XBP1 (accession number: {"type":"entrez-nucleotide","attrs":{"text":"NM_001079539","term_id":"118640872","term_text":"NM_001079539"}} NM_001079539 ) (forward; nt 423–432) 5'-CCTTGTAGTTGAGAACCAGG -3' (reverse; nt 819–838) 5'-GGGGCTTGGTATATATGTGG -3' EDEM1 (accession number: {"type":"entrez-nucleotide","attrs":{"text":"NM_014674","term_id":"197304767","term_text":"NM_014674"}} NM_014674 ) (forward; nt 776–796) 5'- TTGACAAAGATTCCACCGTCC -3' (reverse; nt 1075–1094) 5'- TCCCAAATTCCACCAGGAGG -3' HSPA5 ( GRP78 ) (accession number: {"type":"entrez-nucleotide","attrs":{"text":"NM_005347","term_id":"305855105","term_text":"NM_005347"}} NM_005347 ) (forward; nt 1824–1846) 5'- AGATCACAATCACCAATGACC -3' (reverse; nt 2129–2151) 5'- CTTCCAGTTCCTTCTTCTTAGC -3' DDIT3 (accession number: {"type":"entrez-nucleotide","attrs":{"text":"NM_004083","term_id":"304282232","term_text":"NM_004083"}} NM_004083 ) (forward; nt 194–215) 5'- CATTGCCTTTCTCCTTCGGAC -3' (reverse; nt 555–575) 5'- GCAACTAAGTCATAGTCCGC -3' ACTB (accession number: {"type":"entrez-nucleotide","attrs":{"text":"X00351","term_id":"28251","term_text":"X00351"}} X00351 ) (forward; nt 936–955) 5'- CTGTCTGGCGGCACCACCAT -3' (reverse; nt 1170–1189) 5'- GCAACTAAGTCATAGTCCGC -3' Primers were designed by using the DS Gene 1.5 program for |